- Dernière mise à jour
- 7 août 2023
- Organisation
- EnviDat: le portail de données environnementales
- Catégories
- Éducation, culture et sport
Description
This dataset contains the raw environmental DNA data associated with the publication Environmental drivers of eukaryotic plankton and fish biodiversity in an Arctic fjord in the journal Polar Biology (2023).
Methods
Sampling We sampled the Lilliehöök fjord on the west coast of Spitsbergen (Svalbard, Norway) over 3 days from 3 to 5 of August 2021. Samples were taken from the glacier front up to the fjord mouth of the Krossfjorden system, around 30 km long, after the Lilliehöök fjord merged with the mouth of Möller fjord. The fjord’s maximum depth has been recorded at 373 m (Svendsen et al. 2002) and has no sill at its entrance, thereby facilitating water exchange with the open ocean of the West Spitsbergen Current. We used a research vessel to sample 5 sites for a total of 15 samples, sampling 3 depths per site (3-m, chlorophyll a maximum and 85-m, unless sea floor was shallower). Shallow and intermediate samples between 3-m and 12-m represent ~35-L of water filtered in-situ using long tubing and a peristaltic pump, and all other deeper samples were taken from a total of 3 Niskin bottles (General Oceanics), representing 22-L of water sampled per sample. Water was filtered through a VigiDNA filtration capsule (SPYGEN) with a 0.20-µm pore size using an Athena peristaltic pump (Proactive Environmental Products, Bradenton, Florida) with a flow rate of ~1-L/min. Each sample was handled with single use tubing and gloves.
Molecular To perform the amplification, we used two sets of primers: teleo (forward: ACACCGCCCGTCACTCT, reverse: CTTCCGGTACACTTACCATG; Valentini et al. 2016) and the universal eukaryotic 1389F/1510R primer pair, amplifying the V9-18S rDNA gene (Amaral-Zettler et al. 2009) (forward: TTGTACACACCGCCC, reverse: CCTTCYGCAGGTTCACCTAC).
Data content:
- Metabarcoding data: This zip file contains the 2 sequencing libraries filtered to only retain the samples used in the present study.
- Code, data and figure: This zip file contains all data and code to reproduce the figures and the analysis in the study, with an associated README explaining the content of each folder.
Additional informations For more details, please see the Methods in the associated publication: DOI: 10.1007/s00300-023-03187-9.
Ressources
Informations complémentaires
- Identifier
- 2a7f749a-430f-443b-bbac-073b166c2361@envidat
- Date de publication
- 14 juillet 2023
- Date de modification
- 7 août 2023
- Editeur
- EnviDat
- Points de contact
- Langues
- Anglais
- Informations complémentaires
- -
- Landing page
- https://www.envidat.ch/#/metadata/edna-fjord-svalbard-fish-plankton
- Documentation
-
- Couverture temporelle
- -
- Couverture spatiale
- -
- Intervalle d'actualisation
- -
- Accès aux métadonnées
- API (JSON) Télécharger XML